Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRNA_010567 | |||
Gene | n/a | Organism | Mouse |
Genome Locus | chr13:n/a-n/a:+ | Build | n/a |
Disease | Cardiac fibrosis | ICD-10 | Myocarditis, unspecified (I51.4) |
DBLink | Link to database | PMID | 28412345 |
Experimental Method | |||
Sample Type | Cardiac Fibroblasts (CFs) | Comparison | Ten-week-old male diabetic db/db mice (N = 10) and control db/m mice and newborn C57BL/6 mice (1-3 days) |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CAGCGTCCTTTCTCAAGGGA ReverseGACCTGATTGGCCACTCAGTA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Zhou, B, Yu, JW (2017). A novel identified circular RNA, circRNA_010567, promotes myocardial fibrosis via suppressing miR-141 by targeting TGF-β1. Biochem. Biophys. Res. Commun., 487, 4:769-775. |